uzluga.ru
добавить свой файл

Table S1: list of primers

Gene Acc # primers (5’-3’) frag.(bp) Tm frag. chrom



G3PDH X01677 G3PDH-F GTGAAGGTCGGAGTCAACGGA 300 83 12

G3PDH-3 ggtgaagacgccagtggactc (a) 2154bp


β-ACTIN X00351 actin-5 CCACTGGCATCGTGATGGAC 428 87 7

actin-3 GCGGATGTCCACGTCACACT 523 bp


14-3-3 σ= SFN XM059066 Stra F TAGGCGCTGTTCTTGCTCCAAA 349 87 1

Stra R TTCCCTCAATCTCGGTCTTGCAC 349bp


Cyr61 AF031385 Cyr F TGAGTGCCGCCTTGTGAAAGAA 316 85 1

Cyr R ATGCGGGCAGTTGTAGTTGCATT 431bp


DAB-2 NM001343 DAB-2-F CTCACCACATGACTCCATAGCC 309 85 5

DAB-2-R GGGGACTGATTGAAGACCAAAG 5481bp


TIMP1 X03124 TIMP-1-F TGGACTCTTGCACATCACTACCTG 349 87 X

TIMP-1-R GGAAGAAAGATGGGAGTGGGAACA 1202bp


TIMP2 J05593 TIMP-2-F AGGAAGTGGACTCTGGAAACGACA 310 85 17

TIMP-2-R ATCTTGCACTCGCAGCCCATCT 16370bp


MMP11 X57766 MMP-11-F CTAAAGGTATGGAGCGATGTGAC 327 87 22

=stromelysin3 MMP-11-R TGGGTAGCGAAAGGTGTAGAAG (b) 541bp


TGFBI M77349 BIGH-3-F TGTGTCCACAGCCATTGACCTT 384 85 5

= BIGH3 BIGH-3-R AAGCGATTGTCTCCCTTCAGGA 1842


SPARC J03040 SPARC-F ggatgaggacaacaaccttctg 396 86.5 5

SPARC-R aatccggtactgtggaaggagt 3966bp


FES X52192 FES-F ttcctttgctcatcgaccacct 352 86.5 15

FES-R tgcacaagctccatgacgatgt 1607bp


NOTCH1 M73980 NOT-1-F AGATGCCAACATCCAGGACAAC 309 89 9

NOT-1-R TCTTTGTTAGCCCCGTTCTTCA 1716


SPINT2= HAI-2/ U78095 HAI-2 232 TACCTGACCAAGGAGGAGTGC 408 86 19

NM021102 HAI-2 616 AGGAAGAGGATCAACACCATCAC (a) 8135bp


SERPINB2 M18082 PAI-2-F AACAAGGGACGGGCCAATTTCT 305 83.5 18

= PAI-2 PAI-2-R TTCTGAGGCACACAGCTCATCT 305bp


PAI1 X04429 PAI1-F GAAACCCAGCAGCAGATTCAAGCA 361 85.5 7

SERPINE1 PAI1-R CGTTGAAGTAGAGGGCATTCACCA 3337bp


PLAU M15476 PLAU-F ATTGCCTTGCTGAAGATCCGTTCC 352 84.5 10

PLAU-R TTCCAGTCAAAGTCATGCGGCCTT 1684bp


tPA M15518 tPA-F AACGATGGCCGCATGACTTTGGT 379 84.5 8

tPA-R CTGGAGAGGCTAGTGTGCATTCAT 379bp


uPAR NM002659 uPAR-F TGTAAGACCAACGGGGATTG 405 86 19

uPAR-R ATCCTTTGGACGCCCTTCTT 12120


CDA L27943 CDA-F AGAAGGGTACAAGGATTTCAGGGCA 394 85.5 1

CDA-R TCTAAGTCCCAAGGCAGGTTGCTA 13727


DCK- M60527 DCK-F TTTGTCTTCCTCAGCAGGTTGGC 366 78 4

DCK-R GCAGAACCCTACAAAGCAAAGCA 366bp


ERBB2 M11730 HER-2-F TTTGGCACAGTCTACAAGGGCA 380 86.5 17

HER2/neu HER-2-R TTGGGACTCTTGACCAGCACGTT 1494bp


ERBB3 M29366 ERB-3-F TTGGCTCGGGTGTCTTTGGAACT 373 84.5 12

ERB-3-R TTTCGGGCAGCCAGGTTTCTAT 1250bp


ER X03635 ER-F GCCATTGCCTAGCTTGCCGTAAT 388 79.5 6

ER-R TCCCAGTACCCACAGTCCATCTCA 388bp


MGB1 U33147 MGB1F TGAACACCGACAGCAGCAG 367 60 11

mgb1r TCCGTAGTTGGTTTCTCACC (c) 60 2857


MGB2 AF071219 MGB2F ACTCCTGGAGGACATGGTTGA 245 64 11

MGB2R TCTGAGCCAAACGCCTTGGGT (d) 66 3370


(a): Hamasuna R, Kataoka H, Meng JY, Itoh H, Moriyama T, Wakisaka S, Koono M. . Reduced expression of hepatocyte growth factor activator inhibitor type-2/placental bikunin (HAI-2/PB) in human glioblastomas: implication for anti-invasive role of HAI-2/PB in glioblastoma cells. Int J Cancer. 2001 Aug 1;93(3):339-45.

(b): Giambernardi TA, Grant GM, Taylor GP, Hay RJ, Maher VM, McCormick JJ, Klebe RJ. Overview of matrix metalloproteinase expression

in cultured human cells. Matrix Biol. 1998 Mar;16(8):483-96.

(c): Fiegl M, Haun M, Massoner A, Krugmann J, Muller-Holzner E, Hack R, Hilbe W, Marth C, Duba HC, Gastl G, Grunewald K. Combination of cytology, fluorescence in situ hybridization for aneuploidy, and reverse-transcriptase polymerase chain reaction for human mammaglobin/mammaglobin B expression improves diagnosis of malignant effusions. J Clin Oncol. 2004 Feb 1;22(3):474-83.

(d): Ouellette RJ, Richard D, Maicas E. RT-PCR for mammaglobin genes, MGB1 and MGB2, identifies breast cancer micrometastases in sentinel lymph nodes. Am J Clin Pathol. 2004 May;121(5):637-43.